View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_44 (Length: 247)
Name: NF1624_high_44
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 5281593 - 5281372
Alignment:
| Q |
1 |
tatgcatatgtgggaaccatcgaatacatacttcgtttgaagttggtaaagtatgtttagagaaagtaatttttcataactagatagactttgattttta |
100 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5281593 |
tatgcatatgtgggaaccatcaaatgcatacttggtttgaagttggtaaagtatgtttagagaaagtaatttttcataattagatagactttgattttta |
5281494 |
T |
 |
| Q |
101 |
cctatagtgtactccttaagttgaattgggtggtcaaactaagttgggctttcaagtactttgatttgaaagttgtcgttgaatttgaaagttagtcgat |
200 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
5281493 |
ct------------cttaagttgaattgggtggtcaaattaagttgggctttcaagtactttgatatgaaagttgttgttgaatttaaaagttagtcgat |
5281406 |
T |
 |
| Q |
201 |
tcgactgataact---atcaatgatgatatttta |
231 |
Q |
| |
|
||||||||||||| | |||||||||||||||| |
|
|
| T |
5281405 |
tcgactgataactctcaacaatgatgatatttta |
5281372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University