View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_54 (Length: 231)
Name: NF1624_high_54
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 4135498 - 4135716
Alignment:
| Q |
1 |
agaaggaatgttctatagatcatagcaagggcattatgctttcactgatttgtaattatttgtttacttacaaatacaagtcaattctagcatgtcact- |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4135498 |
agaaggaatgttctatagatcataggaagggcattatgctttcactgatttgtaattatttgtttacttacaaatacaagtcaactctagcatgtcactt |
4135597 |
T |
 |
| Q |
100 |
-atttcttgatcatactttgtgcaatgcagtgtatctttagcaccattgaagaatgcattagattggggatcaagatcatcaaatgtgtgggcagggaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4135598 |
tatttcttgatcatactttgtgcaatgcagtgtatctttggcaccattgaagaatgcattagattggggatcaagaccatcaaatgtgtgggcagggaaa |
4135697 |
T |
 |
| Q |
199 |
gctgcggcagcagtaagtg |
217 |
Q |
| |
|
||||| ||||| ||||||| |
|
|
| T |
4135698 |
gctgctgcagctgtaagtg |
4135716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University