View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_58 (Length: 228)
Name: NF1624_high_58
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 29 - 103
Target Start/End: Original strand, 51709194 - 51709268
Alignment:
| Q |
29 |
tgtggagaaagattcctgaaaaagtagcacaaatatgggatgtatgaagaagatgatttctgattaagtcaactt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51709194 |
tgtggagaaagattcctgaaaaagtagcacaaatatgggatgtatgaagaagatgatttatgattaagtcaactt |
51709268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University