View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_low_16 (Length: 389)
Name: NF1624_low_16
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 144 - 375
Target Start/End: Complemental strand, 46086747 - 46086516
Alignment:
| Q |
144 |
aggtgcaaattggatctcattcctttacgtatgattatgtgtatggtagcacgggacaaccttcatctacgatttacaatgattgtgtagcaccgctcgt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
46086747 |
aggtgcaaattggatctcattcctttacgtatgattatgtgtatggtagcacgggacaaccttcatctactatttacgatgattgtgtagcaccgctcgt |
46086648 |
T |
 |
| Q |
244 |
tgatgcacttttcaatggatataatgccacggttctcgcttatggtcaggtataattttcatttcttggattttttgttatgtaagccttatgattacga |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
46086647 |
tgatgcacttttcaatggatataatgccacggttctcgcttatggtcaggtataattttcatttcttggattttttgttacgtaagccttatgattgcga |
46086548 |
T |
 |
| Q |
344 |
aaaacttatttgagaaacttatgctatatatt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46086547 |
aaaacttatttgagaaacttatgctatatatt |
46086516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 46086870 - 46086822
Alignment:
| Q |
20 |
ggttgcacagattgcatttctgttgttcctggcgaacctcaggtgctac |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46086870 |
ggttgcacagattgcatttctgttgttcctggcgaacctcaggtgctac |
46086822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University