View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_low_24 (Length: 314)
Name: NF1624_low_24
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 5281258 - 5280959
Alignment:
| Q |
1 |
ttgataatgatatcttcaataaatatttatagaaataacacgaatcttattggtcagtcattctggcctacaaagtctagcgctaactattgcaatttga |
100 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5281258 |
ttgataatgatatttacaataaatatttatagaaataacacgaatcttattggccaggcattctggcctacaaagtctagcgctaactattgcaatttga |
5281159 |
T |
|
| Q |
101 |
ttaaacttgcgagtaaggtgcatgtccgtgttagttaatgagtatatgtagtgccccacatttgtcttgtttctcgatggtttgtaacattcttagcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5281158 |
ttaaacttgcgagtaaggtgcatgcccgtgttagttaatgagtatatgtagtgccccacatttgtcttgtttctccatggtttgtaacattcttagcagt |
5281059 |
T |
|
| Q |
201 |
ctatttgggcattagctaatctcagttattgttggtcattttcgacaaagaaccatattatttctaggtgtaaataaaagtatatgatgttggtatttat |
300 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5281058 |
ctatttgggcattagctaatctcagctattgttggtcattttcgacaaacaacgagattatttctaggtgtaaataaaagtatatgatgttgatatttat |
5280959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University