View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_low_29 (Length: 301)
Name: NF1624_low_29
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 136 - 286
Target Start/End: Original strand, 448279 - 448429
Alignment:
| Q |
136 |
ggtggttaaccatcaatttttagtaaatttcaacctcaaaacttgaattagtttcagatatcttttcaaaatttcccttgcatattaggactatcacgta |
235 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| || ||| |
|
|
| T |
448279 |
ggtggttaactatcaatttttagtaaatttcaacctcaaaacttgaattagtttcagatatcgtttcaaaatttcccttgcatattaagactaccatgta |
448378 |
T |
|
| Q |
236 |
actttttcgtagacctgccttcacgctaattaaacatcgtcgtaaaataac |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
448379 |
actttttcgtagacctgccatcacgctaattaaacatcgccgtaaaataac |
448429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 448122 - 448240
Alignment:
| Q |
1 |
ttttttgtccaataataagaacatacttgaattttacaatttgtgaaaacttttttgccaataattcttgagggccttttagaagccacaaatcttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
448122 |
ttttttgtccaataataagaacatacttgaattttacaatttgttaaaacttttttgccaataattcttgagggccttttagaagccacaaatcttttta |
448221 |
T |
|
| Q |
101 |
aagttgaccacaaatcagt |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
448222 |
aagttgaccacaaatcagt |
448240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University