View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_low_50 (Length: 238)
Name: NF1624_low_50
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 65 - 142
Target Start/End: Original strand, 54106519 - 54106596
Alignment:
| Q |
65 |
taatttttatgcgctgaatgtgtatccactaatcaaagatattaaatggacacactaatattaagaaaacaaacattt |
142 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54106519 |
taatttttatgcgccgaatgtgtacccactaatcaaagacattaaatggacacactaatattaagaaaacaaacattt |
54106596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 66
Target Start/End: Original strand, 54106209 - 54106244
Alignment:
| Q |
31 |
ctaattcaaaatataatgtacaaatcaaagagatta |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54106209 |
ctaattcaaaatataatgtacaaatcaaagagatta |
54106244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University