View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16250_low_4 (Length: 288)
Name: NF16250_low_4
Description: NF16250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16250_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 31219539 - 31219802
Alignment:
| Q |
13 |
aatatgagatattt-ctaaattatgtttggaagctggttacattgttaaccaaccacaaaaatatg-----ag-ata-----ttcttgttacttacttga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
31219539 |
aatatgagatattttctaaattatgtttggaagctggttacattgttaaccaaccacaaaaatatttttgcagcattgacccttcttgttacttacttga |
31219638 |
T |
|
| Q |
101 |
acatatcaattgtcttgtgtgaagagtatagacacatgaattgaacttggtacccgtgtttataatggtcacagatttggccacaaatcctcaatcatct |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31219639 |
acatatcaattgtcttgtatgaagagtatagacacgtgaattgaacttggtacccgtgtttataatggtcacagatttggccacaaatcctcaatca--- |
31219735 |
T |
|
| Q |
201 |
tgccttctatatcctgaagttataggatttcaggaatgcaaatagaagcgaaaaagccaggatatgac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31219736 |
-accttctatatcctgaagttataggatttcaggaatgcaaatagaagcgaaaaagccaggatatgac |
31219802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University