View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16250_low_5 (Length: 283)
Name: NF16250_low_5
Description: NF16250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16250_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 279
Target Start/End: Complemental strand, 6400693 - 6400434
Alignment:
| Q |
24 |
tgttttgtgcactttat----gcaagtccaattgagtctgttatgtcccttttacttttgacagataacgggcttttgtttctttgaatagctcgatatt |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400693 |
tgttttgtgcactttatatatgcaagtccaattgagcctgttatgtcccttttacttttgacagataacgggcttttgtttctttgaatagctcgatatt |
6400594 |
T |
 |
| Q |
120 |
tcattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatggtgaggtctacgatgttca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6400593 |
acattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatggtgaggtctacggtgttca |
6400494 |
T |
 |
| Q |
220 |
aacctttggcaatactgcagatgatccgtttgcatataaaacttatttcctatgcttctc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6400493 |
aacctttggcaatactgcagatgatccgtgtgcatataaaacttatttcctatgtttctc |
6400434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University