View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16251_high_7 (Length: 218)
Name: NF16251_high_7
Description: NF16251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16251_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 92 - 202
Target Start/End: Complemental strand, 51844056 - 51843946
Alignment:
| Q |
92 |
tccattattgtcaaaataattacttaatgttgccttcatttatccatagcttctttttatcaaaaattattacatagagaggataataatcttgagaggt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844056 |
tccattattgtcaaaataattacttaatgttgccttcatttatccatagcttctttttatcaaaaattattacatagagaggataataatcttgagaggt |
51843957 |
T |
 |
| Q |
192 |
caaggaaagag |
202 |
Q |
| |
|
||||||||||| |
|
|
| T |
51843956 |
caaggaaagag |
51843946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 51844232 - 51844154
Alignment:
| Q |
1 |
gttgaccggctaccttcatttcaggggttccattttatctttaccatcaatgcatggataatctataactgttccaaaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844232 |
gttgaccggctaccttcatttcaggggttccattttatctttaccatcaatgcatggataatctataactgttccaaaa |
51844154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University