View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16252_high_11 (Length: 210)
Name: NF16252_high_11
Description: NF16252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16252_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 1426833 - 1426708
Alignment:
| Q |
14 |
attattctcagttacttgtgacagcaggttgtatattatgactatcaattttacgtattatcatcttccatatgcataggggtgacactgacataacatt |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1426833 |
attattttcagttacttgtgacagcaggttgtatattatgactatcaattttacgtattatcatcttcc--atgcataggggtgacactgacataacatt |
1426736 |
T |
 |
| Q |
114 |
atgtctctatataactcatggaagttag |
141 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
1426735 |
atgtccctatataactcatggaagttag |
1426708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 192
Target Start/End: Complemental strand, 1426677 - 1426639
Alignment:
| Q |
154 |
tagaagaacattgaagtgttgcaaatctagactaacctg |
192 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
1426677 |
tagaagaacattgaagagttgaaaatctagactaacctg |
1426639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University