View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16255_low_6 (Length: 242)
Name: NF16255_low_6
Description: NF16255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16255_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 45841837 - 45841621
Alignment:
| Q |
10 |
agatgaaggtggttgcactcgttagcggcgggaaagacagttgctacgccatgatgaagtgtattcaatacggccatcagatcgtcgcgttggcgaatct |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841837 |
agatgaaggtggttgcacttgttagcggcgggaaagacagttgctacgccatgatgaagtgtattcaatacggccatcagatcgtcgcgttggcgaatct |
45841738 |
T |
 |
| Q |
110 |
gatgccggttgatgattctgtcgacgaactcgatagctacatgtatcaaactgttggacatcaaattatcatcaaatatgctgagtgtatgggattgcca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45841737 |
gatgccggttgatgattctgtcgacgaactcgatagctacatgtatcaaactgttggacatcaaattatcatcaaatatgctgagtgtatgggattgcca |
45841638 |
T |
 |
| Q |
210 |
ttgttcaggaggagaat |
226 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
45841637 |
ttatttaggaggagaat |
45841621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University