View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16256_high_50 (Length: 226)

Name: NF16256_high_50
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16256_high_50
NF16256_high_50
[»] chr5 (1 HSPs)
chr5 (19-117)||(28203167-28203266)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 28203167 - 28203266
Alignment:
19 acaaagaaacaagttgaggctgctgatgctgctgaacatatcaagaatagactcaatgatcctcatag-taattaattaaattaatgtttagtaattttc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
28203167 acaaagaaacaagttgaggctgctgatgctgctgaacatatcaagaatagactcaatgatcctcatagttagttaattaaattaatgtttagtaattttc 28203266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University