View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_33 (Length: 325)
Name: NF16256_low_33
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 4721189 - 4720880
Alignment:
| Q |
1 |
catgatgctgagtcacacttatatagttggggatatgttgataactgcctctaggttttgaaagcggttagagatgattctgatggctaggattaatcct |
100 |
Q |
| |
|
||||||| ||||||||||||||||||| | | |||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
4721189 |
catgatgttgagtcacacttatatagtcgag--tatgttgataactgcctctaggttttgaaagccgctagagatgattctgacggctaggattaatcct |
4721092 |
T |
 |
| Q |
101 |
gacgcgctccagcactgcaatacgcacagggcttcccgtgcaccttcgtggtgcttttctttgaagaatatgtgccttgtcttcattgggatattcattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4721091 |
gacgcgctccagcactgcaatacgcacagggcttcccgtgcaccttcgtggtgcttttctttgaagaatatgtgccttgtcttcattgggata----ttc |
4720996 |
T |
 |
| Q |
201 |
acacttggccttatgccggtttggtttggaacaactttcatttgcaaattgcaagtaccgtgcatggaatctgctgttgataggggcaagtcttgatcat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4720995 |
acacttggccttatgccggtttggtttggaacaactttcatttgcaaattgcaagtaccgtgcatggaatctgttgttgataggggcaagtcttgatcat |
4720896 |
T |
 |
| Q |
301 |
tttcacgtattctttt |
316 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
4720895 |
tttcacgtattatttt |
4720880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University