View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_35 (Length: 317)
Name: NF16256_low_35
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 38892581 - 38892868
Alignment:
| Q |
1 |
ttcacttgtctctcttctctgttctacatttgcattgctagtttaacattacacgtgtgtgtggataaatatattagcttataatggattagatttaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892581 |
ttcacttgtctctcttctctgttctacatttgcattgctagtttaacattacacgtgtgtgtggataaatatattagcttataatggattagatttaaca |
38892680 |
T |
 |
| Q |
101 |
gtgaacctttgctcattgcattatatcgatcgggaaagaaaacatacggatcaaaataacaagaggcatatgtcacactcacnnnnnnnnnnnnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38892681 |
gtgaacctttgctcattgcattatatcgatcgggaaagaaaacatacggatcaaaataacaagaggcttatgtcacactcacaaaaaagggcaaagtaaa |
38892780 |
T |
 |
| Q |
201 |
nnngtgaacctatgttctttagttttaagttttgactgcggcactcacggcgttaaaattttgtttgtgttcttttggttacatgaga |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892781 |
aaagtgaacctatgttctttagttttaagttttgactgcggcactcacggcgttaaaattttgtttgtgttcttttggttacatgaga |
38892868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University