View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_38 (Length: 277)
Name: NF16256_low_38
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 10 - 207
Target Start/End: Original strand, 12607823 - 12608022
Alignment:
| Q |
10 |
ataatactagttctaatgaatgaaattcagaatgtgaagttctattctttcnnnnnnnnn--tgtgaagttctataaacatgattaatatgaaatcaatt |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12607823 |
ataatattagttctaatgaatgaaattcagaatgtgaagttctattctttcaaaaagaaaaatgtgaagttctataaacatgattaagatgaaatcaatt |
12607922 |
T |
 |
| Q |
108 |
ttaattccaccttaaggttttctgaaaactctctcatccatcttctctatcaacaaatatgatagtcatatgttagcaatcaaacaaaacttcgtttcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607923 |
ttaattccaccttaaggttttctgaaaactctcttatccattttctctatcaacaaatatgatagtcatatgttagcaatcaaacaaaacttcgtttcaa |
12608022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University