View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_40 (Length: 273)
Name: NF16256_low_40
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 4 - 266
Target Start/End: Complemental strand, 6507360 - 6507098
Alignment:
| Q |
4 |
agtaatgcaagtgattcaagtgaacaccaaaatgttgttgattccattagcacaacaaacttcatgcatggtcaatcattttttgactacactccattct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6507360 |
agtaatgcaagtgattcaagtgaacaccaaaatgttgttgattccatttgcacaacaaacttcatgcatggtcaatcattttttgactacactccattct |
6507261 |
T |
 |
| Q |
104 |
ctcaagaagcatataacattaacacaagtgattatagtgaaggattatgggattgcaattacaatgaactttcagctatttttaaccaaccaccaaggag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6507260 |
ctcaagaagcatataacattaacacaagtaattatagtgaaggattatgggattgcaattacaatgaactttcagctatttttaaccaaccaccaaggag |
6507161 |
T |
 |
| Q |
204 |
tgaaattccaagctatggactaatgacaactcaagatgtctcttcaactacctattcttctca |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6507160 |
tgaaattccaagctatggactaatgacaactcaagatgtctcttcaactacctattcttctca |
6507098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University