View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16256_low_44 (Length: 261)

Name: NF16256_low_44
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16256_low_44
NF16256_low_44
[»] chr1 (3 HSPs)
chr1 (191-243)||(12964956-12965008)
chr1 (62-129)||(12964867-12964934)
chr1 (1-70)||(12964394-12964463)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 12964956 - 12965008
Alignment:
191 ttaaaacattcttcaaaacaatttcaatccatgtagtttggaataagaaataa 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
12964956 ttaaaacattcttcaaaacaatttcaatccatgtagtttggaataagaaataa 12965008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 12964867 - 12964934
Alignment:
62 aatagattaataagccttaaaccctaaggataatacgtagattaataagctaataaaatgtatataat 129  Q
    ||||||||||||| || ||||||||||||||||||  |||||||||||||||||||||||||||||||    
12964867 aatagattaataatccctaaaccctaaggataataaatagattaataagctaataaaatgtatataat 12964934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 12964394 - 12964463
Alignment:
1 tagttatgtttgcttttatcaaatagatgcatatcctca-ttgtttggaattttttgaataaaatagatta 70  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||    
12964394 tagttatgtttgcttttatcaaatagatgcatatcctcagttgtttgg-atttttttaataaaatagatta 12964463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University