View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_44 (Length: 261)
Name: NF16256_low_44
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 12964956 - 12965008
Alignment:
| Q |
191 |
ttaaaacattcttcaaaacaatttcaatccatgtagtttggaataagaaataa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12964956 |
ttaaaacattcttcaaaacaatttcaatccatgtagtttggaataagaaataa |
12965008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 12964867 - 12964934
Alignment:
| Q |
62 |
aatagattaataagccttaaaccctaaggataatacgtagattaataagctaataaaatgtatataat |
129 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12964867 |
aatagattaataatccctaaaccctaaggataataaatagattaataagctaataaaatgtatataat |
12964934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 12964394 - 12964463
Alignment:
| Q |
1 |
tagttatgtttgcttttatcaaatagatgcatatcctca-ttgtttggaattttttgaataaaatagatta |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
12964394 |
tagttatgtttgcttttatcaaatagatgcatatcctcagttgtttgg-atttttttaataaaatagatta |
12964463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University