View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_48 (Length: 250)
Name: NF16256_low_48
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 38983983 - 38983751
Alignment:
| Q |
13 |
cataggagctgttacttagtctctgatccactagagaagtctccctaaaagaaagttcactatcctcatgtagaatgtcaaatgagttgtgaagacc--- |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38983983 |
cataggagctgttacttagtccctgatccactagagaagtctccctaaaagaaagttcactatcctcatgtagaatgtcaaatgagttgtgaagagccaa |
38983884 |
T |
|
| Q |
110 |
---------tgaattcgcatcttgcaatgtaatagcaggacctgaactcatatacttcatgattactgtaacattctcattatctttagctccttcattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38983883 |
agcaggatctgaattcgcatcttgcaatgtaatagcaggacctgaactcatatccttcatgattactgtaacattctcattatctttagctccttcattc |
38983784 |
T |
|
| Q |
201 |
tctagattcttttgagtagagaaaggccggttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38983783 |
tctagattcttttgagtagagaaaggccggttt |
38983751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 107
Target Start/End: Complemental strand, 51524246 - 51524174
Alignment:
| Q |
35 |
ctgatccactagagaagtctccctaaaagaaagttcactatcctcatgtagaatgtcaaatgagttgtgaaga |
107 |
Q |
| |
|
|||||||||||| | |||||||| ||||| || |||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
51524246 |
ctgatccactagtggagtctccccaaaaggaacttcattgtcctcatgtaacttgtcaaatgagttgtgaaga |
51524174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 51524113 - 51524065
Alignment:
| Q |
156 |
ttcatgattactgtaacattctcattatctttagctccttcattctcta |
204 |
Q |
| |
|
|||||||||||||| ||| || ||| ||||||||||||||| ||||||| |
|
|
| T |
51524113 |
ttcatgattactgtcacagtcacatcatctttagctccttccttctcta |
51524065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University