View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_5 (Length: 519)
Name: NF16256_low_5
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 314
Target Start/End: Complemental strand, 33238352 - 33238055
Alignment:
| Q |
17 |
aattcaaatgctctcttatgagtctaatgccaggtaactcagagaagtagtccactgcataaaatctgatcttattcttcaatgaatcgaacttgatctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33238352 |
aattcaaatgctctcttatgagtctaatgccaggtaactcagagaagtagtccactgcataaaatctgatcttattcttcaacgaatcgaacttgatctt |
33238253 |
T |
 |
| Q |
117 |
ctgatcatcaacatcccagatcgggatccacaaaatcttgaaatcctctttcttgtaacctgttatcacttgtggattgtcctgcaatctgtcatggata |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238252 |
ctgatcatcgacatcccagatcgggatccacaaaatcttgaaatcctctttcttgtaaccttttatcacttgtggattgtcctgcaatctgtcatggata |
33238153 |
T |
 |
| Q |
217 |
gaatttaacagcaggatctcatcgtcaactttgttgaggcttgaaatgaacaacaacacatatttgtctttgaagacttctatatcctgtttggtaca |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33238152 |
gaatttaacagcaggatctcatcgtcaactttgttgaggcttgaaatgaacaacaacacatatttgtctttgaagacttctatatcctgtttgataca |
33238055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 369 - 519
Target Start/End: Complemental strand, 33238000 - 33237850
Alignment:
| Q |
369 |
gtcgaggctttagtaaattagtactaaccattttgtttttggtggtgccatcatatattaggagattatctccgttgcgttggatcagaagcttcaagaa |
468 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238000 |
gtcgaggctttagtaaattagtactaaccgttttgtttttggtggtgccatcatatattaggagattatctccgttgcgttggatcagaagcttcaagaa |
33237901 |
T |
 |
| Q |
469 |
atctataatatctttaggattggaaattgctttcttgcgcttcaagtattc |
519 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33237900 |
atctataatatctttaggattggaaattgctttcttgcgcttcaagtattc |
33237850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 239
Target Start/End: Complemental strand, 33230560 - 33230457
Alignment:
| Q |
142 |
atccacaaaatcttgaaatcctctttcttgtaa---cctgttatca---cttgtggattgtcctgcaatctgtcatggatagaatttaacagcaggatct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||| ||| || ||||||| |||||||||||||| | || ||| ||||||||||||| |||| |
|
|
| T |
33230560 |
atccacaaaatcttgaaatcctctttcttgaaacttccttttaacacttcttgtggtttgtcctgcaatcttttatagattgaatttaacagcaaaatct |
33230461 |
T |
 |
| Q |
236 |
catc |
239 |
Q |
| |
|
|||| |
|
|
| T |
33230460 |
catc |
33230457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University