View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_53 (Length: 241)
Name: NF16256_low_53
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 37058253 - 37058399
Alignment:
| Q |
12 |
agaagcaaaggggtgaagagaaaaaatagtgagaatcctatgcaaaatatacattgtctgtcggaaatacttttatacccaaaaaatttaatatgcttca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37058253 |
agaagcaaaggggtgaagagaaaaaatagtgagaatcctatgcaaaatatacattgtctgtcggaaatacttttatacccaaaaattttaatatgcttca |
37058352 |
T |
 |
| Q |
112 |
tggttttttctacattccccttgatcaattggaaataattaaccttt |
158 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37058353 |
tggttttttctacattccccttgatgaattggaaataattaaccttt |
37058399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 185 - 223
Target Start/End: Original strand, 37058419 - 37058457
Alignment:
| Q |
185 |
tctctttttcttcatttttatttatcattggggtaaact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058419 |
tctctttttcttcatttttatttatcattggggtaaact |
37058457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University