View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_54 (Length: 241)
Name: NF16256_low_54
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 31714577 - 31714800
Alignment:
| Q |
1 |
tattatcttataataatctcacttaatttcaacatagattagcatgaggaagagaagtattattgagagaactaaaaatttgattgattctaaatgtcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31714577 |
tattatcttataataatctcacttaatttcaacatagattagcatgaggaagagaagtattattgagagaactaaaaatttgattgattataaatgtcaa |
31714676 |
T |
|
| Q |
101 |
atgtaacaggtatttctaatagagttcggagattttagatatacttctaactttagagagaaaaattgtatctagtcttttcaattaagagtaaataaat |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31714677 |
atgtaacaggtatttctattagagttcggagattttagatatacttctaactttagagagaaaaattgtatttagtcttttcaattaagagtaaataaat |
31714776 |
T |
|
| Q |
201 |
gtacataaaaaaggtagttggcaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31714777 |
gtacataaaaaaggtagttggcaa |
31714800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University