View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16256_low_57 (Length: 219)
Name: NF16256_low_57
Description: NF16256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16256_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 60 - 192
Target Start/End: Complemental strand, 9826244 - 9826111
Alignment:
| Q |
60 |
tattataccaactttcattttgaaactgatgcggtacattttagtttcttaagaaaatatattatatttaaatgttttaattcattattcctgtnnnnnn |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9826244 |
tattataccaactttcattttgaaactgatgcgctacattttagtttcttaagaaaatatattatatttaaatgttttaattcattattcctgtaaaaaa |
9826145 |
T |
 |
| Q |
160 |
nctgttttaa-tattattactatgttttaattat |
192 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| |
|
|
| T |
9826144 |
actgttttaattattattactatgttttatttat |
9826111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University