View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16257_high_12 (Length: 339)

Name: NF16257_high_12
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16257_high_12
NF16257_high_12
[»] chr5 (1 HSPs)
chr5 (19-326)||(11710110-11710417)


Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 11710417 - 11710110
Alignment:
19 ggcatctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaact 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11710417 ggcatctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaact 11710318  T
119 ggtgactcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11710317 ggtgactcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcat 11710218  T
219 tgtagtgtttggcattataagatggaggacaactctgcagagnnnnnnncacgtaacagctatttagttgctgaaaattcctccaacaaaatgacataca 318  Q
    ||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||    
11710217 tgtagtgtttggcattataagatggaggacaactctgcagagaaaaaaacacgtaacagctatttagttgctgaaaattcctccaacaaaatgacataca 11710118  T
319 ttttagta 326  Q
    ||||||||    
11710117 ttttagta 11710110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University