View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16257_high_12 (Length: 339)
Name: NF16257_high_12
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16257_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 11710417 - 11710110
Alignment:
| Q |
19 |
ggcatctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11710417 |
ggcatctctttcagtctgaagtttctctagctgctgatcaatggttgctaaaaacaaatgaggatgggtttgcaaaatttgttccaacagctgaccaact |
11710318 |
T |
 |
| Q |
119 |
ggtgactcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11710317 |
ggtgactcaaattggagaggaggagaaggcacaaaattatcacttgaatctgtagatgctctcacaactaaccctctacctcgaaaactgtagggttcat |
11710218 |
T |
 |
| Q |
219 |
tgtagtgtttggcattataagatggaggacaactctgcagagnnnnnnncacgtaacagctatttagttgctgaaaattcctccaacaaaatgacataca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11710217 |
tgtagtgtttggcattataagatggaggacaactctgcagagaaaaaaacacgtaacagctatttagttgctgaaaattcctccaacaaaatgacataca |
11710118 |
T |
 |
| Q |
319 |
ttttagta |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
11710117 |
ttttagta |
11710110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University