View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16257_low_17 (Length: 331)
Name: NF16257_low_17
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16257_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 20 - 141
Target Start/End: Original strand, 31265872 - 31265993
Alignment:
| Q |
20 |
tccaaaggtagtgcgcaagaaatcaaagcatgagatacatagcaatcaatcatcattgggtattaaaaggtgggtcaattatttaacaggtcaaaaacga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31265872 |
tccaaaggtagtgcgcaagaaatcaaagcatgagatacatagcaatcaatcatcattgggtattaaaaggtgggtcaattatttaacaggtcaaaaacga |
31265971 |
T |
 |
| Q |
120 |
tatatgtgaatggatttctaac |
141 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31265972 |
tatatgtgaatggatttctaac |
31265993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 208 - 310
Target Start/End: Original strand, 31266060 - 31266162
Alignment:
| Q |
208 |
gaagaaattggggtccaagggttgttgaaaattagttagaaaggaaattagttttcattgttaacaagcagatagatcagtcggtcacttccttgataat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31266060 |
gaagaaattggggtccaagggttgttgaaaattagttagaaaggaaattagttttcattgttaacaagcagatagatcagtcggtcacttccttgataat |
31266159 |
T |
 |
| Q |
308 |
aac |
310 |
Q |
| |
|
||| |
|
|
| T |
31266160 |
aac |
31266162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University