View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16257_low_25 (Length: 256)

Name: NF16257_low_25
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16257_low_25
NF16257_low_25
[»] chr7 (1 HSPs)
chr7 (117-250)||(46891898-46892030)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 117 - 250
Target Start/End: Complemental strand, 46892030 - 46891898
Alignment:
117 tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattaac 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
46892030 tgaggctggagtgtgaggagggttccatgtgaaatttagaatgtttggatggtagactagccaatgttcaaggattctgccaatggggttttccattcac 46891931  T
217 ctcttttttgggtttgggggagaagtgcctttgt 250  Q
    ||| ||||||||||||||||||||||||||||||    
46891930 ctc-tttttgggtttgggggagaagtgcctttgt 46891898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University