View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16257_low_26 (Length: 242)
Name: NF16257_low_26
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16257_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 34 - 121
Target Start/End: Original strand, 7303521 - 7303608
Alignment:
| Q |
34 |
catggggtttgaaattgggagaaagagaaacataatatcatcgaaaacaaatctcaataaatagagaaaccaatttttaatttgagtg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7303521 |
catggggtttgaaattgggagaaagagaaacataatatcatcgaaaacaaatctcaataaatagagaaaccaatttttaaattgagtg |
7303608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 181 - 228
Target Start/End: Original strand, 7303660 - 7303707
Alignment:
| Q |
181 |
tggcccctaagtaattaagtgatgtgtcttggtttgcctatatcaaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7303660 |
tggcccctaagtaattaagtgatgtgtcttggtttgcctatatcaaag |
7303707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University