View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16257_low_28 (Length: 216)
Name: NF16257_low_28
Description: NF16257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16257_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 30 - 200
Target Start/End: Complemental strand, 35743193 - 35743023
Alignment:
| Q |
30 |
attttattagggcatcaaagttagattttgtattcatgattgatcactatgatttgttattattagggcattcaaagttagattttgcattgactcttct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743193 |
attttattagggcatcaaagttagattttgtattcatgattgatcactatgatttgttattattagggcattcaaagttagattttgcattgactcttct |
35743094 |
T |
 |
| Q |
130 |
gatatttcttgtgttgcatcggtattttgaagtcatatcgtaatatttacacttctgcttgcttgaatttg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743093 |
gatatttcttgtgttgcatcagtattttgaagtcagatcgtaatatttacacttctgcttgcttgaatttg |
35743023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University