View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16258_high_25 (Length: 214)
Name: NF16258_high_25
Description: NF16258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16258_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 8797482 - 8797668
Alignment:
| Q |
14 |
agagatgattgagaatttgtctgatnnnnnnnccctaatgtcggttcgtgaattagcgaaagggatcacttataccgaacctttgcctactgggtggaag |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8797482 |
agagatgattgagaatttgtctgataaaaaaaaccttatgtcggttcgtgaattagcgaaagggatcacttataccaaacctttgcctactgggtggaag |
8797581 |
T |
|
| Q |
114 |
cctcctttgcatattagaaggatgtcaaagaaagattgtgatttgattcaaaaactgtggcatataattgccaatggtgaagatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8797582 |
cctcctttgcatattagaaggatgtcaaagaaagattgtgatttgattcaaaaactgtggcatataattgtcaatggtgaagatatt |
8797668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 43125060 - 43125241
Alignment:
| Q |
15 |
gagatgattgagaatttgtctgatnnnnnnnccctaatgtcggttcgtgaattagcgaaagggatcacttataccgaacctttgcctactgggtggaagc |
114 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
43125060 |
gagatgattgagaatttgtcggataagaaaacccttatgtctgttcgtgaattagcgaaagggattacttatactgagcctttgcctactgggtggaagc |
43125159 |
T |
|
| Q |
115 |
ctcctttgcatattagaaggatgtcaaagaaagattgtgatttgattcaaaaactgtggcatataattgccaatggtgaaga |
196 |
Q |
| |
|
||||||||||||| || |||||||| ||||| ||||||||||||||||| |||| ||||||||||||| || |||||||| |
|
|
| T |
43125160 |
ctcctttgcatataaggaggatgtcgaagaaggattgtgatttgattcagaaacaatggcatataattgttaacggtgaaga |
43125241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University