View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16258_low_13 (Length: 358)
Name: NF16258_low_13
Description: NF16258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16258_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 23 - 333
Target Start/End: Original strand, 4116579 - 4116889
Alignment:
| Q |
23 |
taaggaaatttgataaacaagtttaactgggaagaaaagaggagaaaacgaaaggcaaaaataaaactaatctaaatttcgtgtgactatgcttcatatc |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4116579 |
taaggaaatttgataaacaagtttaacggggaagaaaagaggagaaaatgaaaggcaaaaatgaaactaatctaaatttcgtgtgactatgcttcatatc |
4116678 |
T |
 |
| Q |
123 |
gtccacactccttatatgctgcctgatctgaataattttggttccaacttatgacagacgcacgatatactcgtgatatgtgtctctcatctcttatggt |
222 |
Q |
| |
|
|| |||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4116679 |
gtgtacactcctcatatgctgcctgatttgaataattttggttccaacttatcacagacgcacgatatactcgtgatatgtgcatcttatctcttatggt |
4116778 |
T |
 |
| Q |
223 |
acactttacaacattgaatctcaagtgtactaaatattacctttcaatagagctgttgagctctttgtttccatcaactacgtcatttagcatgcatatt |
322 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4116779 |
acactttacaacattgaatttcaagtgtactaaatatgacctttcaatagagttgttgagctctttgtttccatcaactacgtcatttagcatgcgtatt |
4116878 |
T |
 |
| Q |
323 |
attattaatta |
333 |
Q |
| |
|
||||||||||| |
|
|
| T |
4116879 |
attattaatta |
4116889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University