View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16258_low_21 (Length: 297)
Name: NF16258_low_21
Description: NF16258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16258_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 38982388 - 38982613
Alignment:
| Q |
20 |
attaaatagagataaattctaagacatcgatgcagacatactcgggagggagggtatggttctctctcctctccctaaccgtttttctccggtgaattta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38982388 |
attaaatagagataaattctaagacatcgatgcagagaaactcggga----gggtatggttctctctcctctccctaaccgtttttctccggtgaattta |
38982483 |
T |
|
| Q |
120 |
tctaccttcggtgcagctccggtggccgttttttcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38982484 |
tctaccttcggtgcagctccggtggccgttttttcaccgttttattcgattatcttcgtcgtttcacatgcgtttcttgcctccatcatctgcatcgctt |
38982583 |
T |
|
| Q |
220 |
ctctccgcgggctttttgcgtctttgtgtt |
249 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |
|
|
| T |
38982584 |
ctctccgcgggctttttgcctcttagtgtt |
38982613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University