View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16258_low_7 (Length: 404)
Name: NF16258_low_7
Description: NF16258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16258_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 332
Target Start/End: Original strand, 46612623 - 46612938
Alignment:
| Q |
19 |
aaaaatgctttaccaaataaactataagcgtgtttaccgtcttt-----gcgtagagaaacgagttgacacttttcatttacgtggtctgggtttatggt |
113 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46612623 |
aaaaatgctttatcaaataagctataagcgtatttaccgtctttaatttgcgtagagaaaggtgttgacacttttcatttacgtggtctgggtttatggt |
46612722 |
T |
 |
| Q |
114 |
tagatatttgaaagctaaaagtttcacnnnnnnntaaacaatcttatttagcgaatgtgttgtggctatttaagtttccatgtttccttaattctattct |
213 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46612723 |
taggtatttgaaagctaaaagtttcacaaaaaaataaacaatcttatttagcgaatgtgttgtggctatttaagtttccatgtttccttaattctattc- |
46612821 |
T |
 |
| Q |
214 |
tcactgaaggatttgtttagatgaaattttaactcgcatatcaaaactattacggcttaacgatctattaatttgacaacatgggaaggtggtagcagtg |
313 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46612822 |
--accgaaggatttgtttagatgaaattttaactcgcatatcaaaactattacggcttaacgatctattaatttgacaacatgggaaggtggtagcagtg |
46612919 |
T |
 |
| Q |
314 |
tggaagcaagggcactgtc |
332 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46612920 |
tggaagcaagggcactgtc |
46612938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University