View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16259_high_1 (Length: 597)
Name: NF16259_high_1
Description: NF16259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16259_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 6e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 383 - 582
Target Start/End: Complemental strand, 51844413 - 51844214
Alignment:
| Q |
383 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
482 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844413 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
51844314 |
T |
 |
| Q |
483 |
attttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccggctaccttcat |
582 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844313 |
attttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccggctaccttcat |
51844214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 51844795 - 51844664
Alignment:
| Q |
1 |
taaatcagtaagatgaagacttgagacgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatgatgcaaga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844795 |
taaatcggtaagatgaagacttgagatgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatgatgcaaga |
51844696 |
T |
 |
| Q |
101 |
gattgcgtgtttgtgaaggattgtttgagttt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51844695 |
gattgcgtgtttgtgaaggattgtttgagttt |
51844664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 209 - 290
Target Start/End: Complemental strand, 51844587 - 51844506
Alignment:
| Q |
209 |
cgaacagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844587 |
cgaacagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
51844506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University