View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16259_low_16 (Length: 228)
Name: NF16259_low_16
Description: NF16259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16259_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 31114151 - 31114352
Alignment:
| Q |
10 |
acatcatccaaattttgatttatgtaagcttgtgttacattaaacaaatttcatgcattattgaatacatacgacgctgatagaaaacaacaaaaattga |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114151 |
acatcatccaaattttgattaatgtaagcttgtgttacattaaacaaatttcatgcattattgaatacatacgacgctgatagaaaacaacaaaaattgg |
31114250 |
T |
|
| Q |
110 |
gagaaaatatatcgtgtaggaggaacttcgcaaagctctatcattcttcttccacttcctcaagttcaaacaaacaccactgacacggtggccgctgaca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
31114251 |
gagaaaatatatcgtgtaggaggaacttcgcaaagctctatcattcttcttccacttcctcaagttcaaacaaacgccactgacacagtggccgctgaca |
31114350 |
T |
|
| Q |
210 |
gt |
211 |
Q |
| |
|
|| |
|
|
| T |
31114351 |
gt |
31114352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University