View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16259_low_19 (Length: 215)
Name: NF16259_low_19
Description: NF16259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16259_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 35 - 196
Target Start/End: Original strand, 10984943 - 10985104
Alignment:
| Q |
35 |
ctgggctgtgattgctataggatggggtactataggttctgctgtgataattgctttgccaataatagagagctgggataccatccaaactgttattcta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10984943 |
ctgggctgtgattgctataggatggggtactataggttctgctgtgataattgctttgccaataatagagagctgggataccatccaaactgttattcta |
10985042 |
T |
 |
| Q |
135 |
ggaatgtttacaaatgacagactcgtggaaaaggtggatgagttaaatttcaagttgcatac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10985043 |
ggaatgtttacaaatgacagactcgtggaaaaggtggatgagttaaatttcaagttgcatac |
10985104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University