View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16260_high_12 (Length: 204)
Name: NF16260_high_12
Description: NF16260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16260_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 188
Target Start/End: Complemental strand, 20967222 - 20967041
Alignment:
| Q |
7 |
tggaggaacacagaactaggttacagtcttcgttcttcacttgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
20967222 |
tggaggaaccaagaactaggttacagtcttcgttcttcacttgatagtgattgagtacaaaatctttggaaatggttataaactgactaggaaaggaata |
20967123 |
T |
|
| Q |
107 |
gtctttgttcttgcacgaaaacattgtgaggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20967122 |
gtctttgttcttgcacgaaaacattgtgaggtgtttagggttttgtggagatgatttaatgaggtgcattttggcgaaggtg |
20967041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 7 - 188
Target Start/End: Complemental strand, 20980039 - 20979853
Alignment:
| Q |
7 |
tggaggaacacagaactaggttacagtcttcgttcttcacttgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata |
106 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20980039 |
tggaggaaccaagaacccggttacagtcttcgttattaaattgatagtgactgagtacgaaatcttcggaaatggttataaactgattaggcaaggaata |
20979940 |
T |
|
| Q |
107 |
gtctttgttcttgcacgaaaacattgtga-----ggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20979939 |
gtctttgttcttgcacgaaaacattgtgaggtgaggtgtttagggtttcgtggagatgatttaatgaggtgcattttggcgaaggtg |
20979853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University