View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16261_low_6 (Length: 259)
Name: NF16261_low_6
Description: NF16261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16261_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 54774575 - 54774823
Alignment:
| Q |
11 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774575 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
54774674 |
T |
 |
| Q |
111 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774675 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
54774774 |
T |
 |
| Q |
211 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaaacagtttac |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774775 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaaacagtttac |
54774823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 216 - 253
Target Start/End: Complemental strand, 30163389 - 30163352
Alignment:
| Q |
216 |
ccaagaaaccgtatttctctcaggcattctgtcaaaca |
253 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30163389 |
ccaagaaaccacatttctctcaggcattctgtcaaaca |
30163352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University