View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16262_low_11 (Length: 238)
Name: NF16262_low_11
Description: NF16262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16262_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 31974506 - 31974694
Alignment:
| Q |
18 |
atatataatatgacctcaatgttgtaaactctgttcagaacccacgaaaatgnnnnnnnatactatttgaaaatacatggaaactctcaaacagataaaa |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31974506 |
atatataatatgaccttaatgttgtaaactctgttcagaacccacgaaaatgtttttttatactatttgaaaatacatggaaactctcaaacagataaaa |
31974605 |
T |
|
| Q |
118 |
tata--ggacagatgcttgtccttcatcctctgatcagctcacgaagggaagattcgaatttgttttcaagttgatttcatattttcca |
204 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31974606 |
tattagggacagatgcttgtccttcatcctctgatcagctcacgaagggaagattcgaatttgttttcaagttgatttcatattttcca |
31974694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University