View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16262_low_8 (Length: 320)
Name: NF16262_low_8
Description: NF16262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16262_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 306
Target Start/End: Original strand, 5131486 - 5131778
Alignment:
| Q |
14 |
ttctataggatggaacttctcactacttgaaaggcattattctcttgctcttgtacattgttattggtgcctgcttttttgtacaaagaacagcctccgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5131486 |
ttctataggatggaacttctcactacttgaaaggcattattctcttgctcttgtacattgttattggtgcctgcttttttgtacaaaaaacagcctccgg |
5131585 |
T |
 |
| Q |
114 |
taagcatgatatgtaataacatattcaaatatagattccgtgtgaaaggacgcaattgtcgtaccagcaaatcaattttcttagatcaagataagacaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5131586 |
taagcatgatatgtaataacatattcaaatatagattccgtgtgaaagtacgcaattgtcgtaccagcaaatcaattttcttagatcaagataagacaac |
5131685 |
T |
 |
| Q |
214 |
tcatattcaaattggtaattttaaatcatattcactaaagtcaacacgtgaggggtccgatcttgatccgacattgttgatttgttgattgtg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5131686 |
tcatattcaaattggtaattttaaatcatattcactaaagtcaacacgtgaggggtccgatcttgatccgacattgttgatttgttgattgtg |
5131778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 25013082 - 25012996
Alignment:
| Q |
19 |
taggatggaacttctcactacttgaaaggcattattctcttgctcttgtacattgttattggtgcctgcttttttgtacaaagaaca |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| | || | ||| ||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
25013082 |
taggatggtacttctcactacttgaaaggccttattctcctactttgctactttgttattggtgcttgcttctttgtgcaaagaaca |
25012996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University