View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_high_18 (Length: 300)
Name: NF16264_high_18
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_high_18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 12 - 300
Target Start/End: Complemental strand, 36458485 - 36458197
Alignment:
| Q |
12 |
atgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccactaaactcaaggtcagccgggcggtcggaaactctcatcaagccg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458485 |
atgaagtatatgatcaaattctgcaacttatatggtggtctggaacgtgttgccactaaactcaaggtcagccgggcggtcggaaactctcatcaagccg |
36458386 |
T |
|
| Q |
112 |
cgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttggttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36458385 |
cgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttgggtt |
36458286 |
T |
|
| Q |
212 |
agaagtgacagtttaggattagaaaaagaaaattgtaaaaatatattggtattctttgttttggaatcaacgttattactttaatgtct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458285 |
agaagtgacagtttaggattagaaaaagaaaattgtaaaaatatattggtattctttgttttggaatcaacgttattactttaatgtct |
36458197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 167
Target Start/End: Complemental strand, 40874816 - 40874742
Alignment:
| Q |
93 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatgaaggacatttatttt |
167 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||||||| ||||| || |||||||| |||| ||| | ||||||| |
|
|
| T |
40874816 |
ggaaagtctcatcaagctggatcagatagtttgttgacgtggcatgcatttaagaaaatgatggatacttatttt |
40874742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 93 - 153
Target Start/End: Complemental strand, 40871718 - 40871658
Alignment:
| Q |
93 |
ggaaactctcatcaagccgcgtcagatagtttgttgacatggcaagcttttaagaagatga |
153 |
Q |
| |
|
||||| || |||||||| | ||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
40871718 |
ggaaagtcgcatcaagctggatcagatagtttgttgacatggcatgcatttaagaaaatga |
40871658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University