View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_high_24 (Length: 236)
Name: NF16264_high_24
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 893717 - 893510
Alignment:
| Q |
19 |
gtttttcccatctcatgtctcgggtttatttaatttctctgatttttcttctaattcttctgttgtattttcaaaatcaatattttaacttttacacttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893717 |
gtttttcccatctcatgtctcgggtttatttaatttctctgatttttcttctaattcttctgttgtattttcaaaatcaatattttaacttttacacttc |
893618 |
T |
|
| Q |
119 |
tcttttctgaacaaaaagtgtagttttagaaaacatgcgcatctttgagagcaatgagtatggtacttatgtatatggatacaattagtgatttcttttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
893617 |
tcttttctgaacaaaaagtgtagttttagaaaacatgcgcatctttgagagcaatgagtatggtacttatgtatatggatacaattagtgatttcttttt |
893518 |
T |
|
| Q |
219 |
gtcctttg |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
893517 |
gtcctttg |
893510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University