View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_high_25 (Length: 232)
Name: NF16264_high_25
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 16510117 - 16509921
Alignment:
| Q |
18 |
gaacaatccattgaaacttatacgacgtatgcggattcggaaaatcaaaataaataatctcattatcaaccaatcttctcactcctttagcagtagaagt |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16510117 |
gaacgatccattgaaacttatacgacgtatgcggattcggaaaatcaaaataaataatctcattatccaccaatcttctcactcctttagcagtagaagt |
16510018 |
T |
|
| Q |
118 |
agcaatctcaatcttccttcccaacaatgaccacccaggctcaacaggaaactcaccatcctcgagattcggaatcagaatcttcttctcctcaact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||| |||||| |
|
|
| T |
16510017 |
agcaatctcaatcttccttcccaacaatgaccacccaggctcaacaggaaactcaccatcctcaagattcggaatctggatcttcttctcttcaact |
16509921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University