View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_low_15 (Length: 309)
Name: NF16264_low_15
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 253
Target Start/End: Original strand, 27819589 - 27819816
Alignment:
| Q |
26 |
tatatgtgtcgcttataaggcaactaacattttacacaacaaagttttggtagtaatctatttctgaaaaatagatataaccaaagctttcgataccttg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
27819589 |
tatatgtgtcgcttataaggcaactaacattttacacaacaaagttttggtagtaatctatttctgaaaaatagatgtaaccaaagctttt-ataccttg |
27819687 |
T |
|
| Q |
126 |
gagtggtctttttt-ctcaaagtattgaaaggatttaggttcaatctagtgttctgcagttggattgaagccattttcaaattagcaactctatctatat |
224 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819688 |
gagtggtcttttttgctcaaagtattgaaaggatttaggttcaatctagtgttctgcagttggattgaagccattttcaaattagcaactctatctatat |
27819787 |
T |
|
| Q |
225 |
atctattgatggtgaaatgcatggttact |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27819788 |
atctattgatggtgaaatgcatggttact |
27819816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 27819558 - 27819590
Alignment:
| Q |
27 |
atatgtgtcgcttataaggcaactaacatttta |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27819558 |
atatgtgtcgcttataaggcaactaacatttta |
27819590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University