View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_low_23 (Length: 249)
Name: NF16264_low_23
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 27819518 - 27819282
Alignment:
| Q |
1 |
tgaaatccctttgctcctttgaaatgttgttgggcattatctgggacaatctatcagctaaaactctagagattatcttgaatttgaaatttaccattgc |
100 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819518 |
tgaaacccctttgctcctttgaaatgatgttgggcattatctgggacaatctatcagctaaaactctagagattatcttgaatttgaaatttaccattgc |
27819419 |
T |
|
| Q |
101 |
tattggtttgtactaatcaaatatttgcattgaagtttggcagcaactatcatgtgttgaagaactcaatgatttgcattgattacatcttagttgtatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819418 |
tattggtttgtactaatcaaatatttgcattgaagtttggcagcaactatcatgtgttgaagaactcaatgatttgcattgattacatcttagttgtatt |
27819319 |
T |
|
| Q |
201 |
ctttatttcatcaattatatgaaaatagttgctgttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819318 |
ctttatttcatcaattatatgaaaatagttgctgttc |
27819282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University