View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_low_29 (Length: 213)
Name: NF16264_low_29
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0249 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 20642930 - 20643142
Alignment:
| Q |
1 |
gacataaatgtgggtaactttcccagccgagattcaaaccttgtttcgtcacgtgggcatggaagaatctagctcatttgaggtggatcaattgaacccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20642930 |
gacataaatgtgggtaactttcccagccgagattcaaaccttgtttcgtcacgtgggcatggaagaatctagctcatttgaggtggatcaattgaacccc |
20643029 |
T |
 |
| Q |
101 |
taaactttaaaaagcaatgcaaatataaccctatatatttcacattttgaacccctaaaaatttctttttacaccgctatctcgataactctaaagtttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
20643030 |
taaactttaaaaagcaatgcaaatataaccctatatatttcacattttgaacccctaaaaatttctttttacaccactatctcgataactctaaagttcg |
20643129 |
T |
 |
| Q |
201 |
aacccttagatca |
213 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
20643130 |
aacccctagatca |
20643142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0249 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0249
Description:
Target: scaffold0249; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 21792 - 21729
Alignment:
| Q |
88 |
tcaattgaacccctaaactttaaaaagcaatgcaaatataaccctatatatttcacattttgaaccc |
154 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
21792 |
tcaactgaacccctaaactaaaaaaa---atgcaaatatacccctatatatttttcattttgaaccc |
21729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University