View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16264_low_30 (Length: 208)
Name: NF16264_low_30
Description: NF16264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16264_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 5395832 - 5396001
Alignment:
| Q |
24 |
gccagatgctttagctaaccaccagttcannnnnnnnn-cttttcaaagataatgtgatgttgaatcatgatgtttgtgtattataggtgacatgctatt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5395832 |
gccagatgctttagctaaccaccagttcattttttttttcttttcaaagataatgtgatgttgaatcatgatgtttgtgtagtataggtgacatgctatt |
5395931 |
T |
|
| Q |
123 |
aaaatctgtattgcttgagacagtgagtgccataaggccatgacattctcgtttttattatattaatatt |
192 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395932 |
aaaagctgtattgcttgagacagtgagtgccataaggccatgacattctcgtttttattatattaatatt |
5396001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University