View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_high_16 (Length: 389)
Name: NF16265_high_16
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 41077803 - 41077586
Alignment:
| Q |
9 |
agcagagaaaactatgtaaaagtagaagactcgtaaaagggtgtgtcttgcacaattttatgtgtaagttggagtgaggtggtttaataggggaggtgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077803 |
agcagagaaaactatgtaaaagtagaagactcgtaaaagggtgtgtcttgcacaattttatgcgtaagttggagtgaggtggtttaataggggaggtgat |
41077704 |
T |
|
| Q |
109 |
gaggaagttggggaatggtatggatacttgtttttggaaggatagggtggttgccaaatgggccgctttgtgatcgtttccctcagctattttcgataac |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077703 |
gaggaagttgggaaatggtatggatacttgtttttggaaggatagggtggttgccaaatgggccgctttgtgatcgtttccctcagctattttcgataac |
41077604 |
T |
|
| Q |
209 |
cttggagaaagatattaa |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41077603 |
cttggagaaagatattaa |
41077586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 261 - 368
Target Start/End: Complemental strand, 41077551 - 41077444
Alignment:
| Q |
261 |
acgagatggtcttttcaatgtgggagtcggagcttttgcaagagcctcgagagggcttagtaggtgtagtggtgggggagggtgaggatgtgtggtggtg |
360 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41077551 |
acgagatggtcttttcaatgtgggagttggagcttttgcaagagcttcgagagggcttagtaggtgtagtggtgggggagggtgaggatgtgcggtggtg |
41077452 |
T |
|
| Q |
361 |
gaaatccg |
368 |
Q |
| |
|
|||||||| |
|
|
| T |
41077451 |
gaaatccg |
41077444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 19110747 - 19110715
Alignment:
| Q |
117 |
tggggaatggtatggatacttgtttttggaagg |
149 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
19110747 |
tggggaatggtatggatactagtttttggaagg |
19110715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 99 - 151
Target Start/End: Original strand, 43459467 - 43459519
Alignment:
| Q |
99 |
gggaggtgatgaggaagttggggaatggtatggatacttgtttttggaaggat |
151 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
43459467 |
gggaggttatgaggaaggtggggaatggtggggatacgcgtttttggaaggat |
43459519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University