View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_high_40 (Length: 236)
Name: NF16265_high_40
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33378762 - 33378982
Alignment:
| Q |
1 |
atgctgtcggattattgattgcattgctgttgaagttaaagaaggatagagattcggttacctcaatgtaccaagtctaccgacaacatgatccgtcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33378762 |
atgctgtcggattattgattgcattgctattgaagttaaagaaggatagagattcggttacctcaatgtaccaagtctaccgacaacatgatccgtcttg |
33378861 |
T |
|
| Q |
101 |
ggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaacttgttttcaaatatgaatgagaatgttctttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33378862 |
ggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaacttgttttcaaatatgaatgagaatgttctttca |
33378961 |
T |
|
| Q |
201 |
tgctcattttactttggaact |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33378962 |
tgctcattttactttggaact |
33378982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 33384953 - 33385090
Alignment:
| Q |
84 |
caacatgatccgtcttgggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaacttgttttcaaatatga |
183 |
Q |
| |
|
||||||||| | |||||||||| ||| ||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33384953 |
caacatgattcatcttgggagaacatgaaatcttatggcggtttggtattggatggctttcttgtgccacaagtaattctaaacttgttttcaaatatga |
33385052 |
T |
|
| Q |
184 |
atgagaatgttctttcatgctcattttactttggaact |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33385053 |
atgagaatgttctttcatgttcattttactttggaact |
33385090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University