View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_high_41 (Length: 234)
Name: NF16265_high_41
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 52117713 - 52117627
Alignment:
| Q |
1 |
tttttcttctctcttgtttctatcgtattgacnnnnnnnaagtagcactcttgcattttatcactcaaatgctacaaaccatctcac |
87 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52117713 |
tttttcttcactcttgtttctctcgtattgactttttttaagtagcactcttgcattttatcactcaaatgctacaaaccatctcac |
52117627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 217
Target Start/End: Complemental strand, 52117526 - 52117496
Alignment:
| Q |
187 |
cacaattaatcaaattactcaaccaagataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52117526 |
cacaattaatcaaattactcaaccaagataa |
52117496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University