View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16265_high_43 (Length: 223)
Name: NF16265_high_43
Description: NF16265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16265_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 30247294 - 30247114
Alignment:
| Q |
17 |
agttttatcatcagagacttggatgaatgtgatgcaagcaaattctttaattaatcctatgtcaatgctcttgcttcttgggagttacaattattattaa |
116 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30247294 |
agttttattatcagagacttggatgcatgtgatgtaagcaaattctttaattaatcctatgtcaatgctcttgcttcttgggagttacaattattattaa |
30247195 |
T |
|
| Q |
117 |
tttctattgggtaacataccaagtttcttgtacaaccat--tattccaataaacaagtacaaagtgccagttgaactagta |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||| ||||||| ||||||| | ||||||||| |||| |
|
|
| T |
30247194 |
tttctattgggtaacataccaaatttcttgtacaaccattatattccactaaacaaatacaaagaggcagttgaaccagta |
30247114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 17 - 86
Target Start/End: Complemental strand, 30783542 - 30783473
Alignment:
| Q |
17 |
agttttatcatcagagacttggatgaatgtgatgcaagcaaattctttaattaatcctatgtcaatgctc |
86 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783542 |
agttttatcatcagagacttggatgcatgtgatgtaagcaaattctttaattaatcctatgtcaatgctc |
30783473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 83 - 143
Target Start/End: Complemental strand, 30783313 - 30783253
Alignment:
| Q |
83 |
gctcttgcttcttgggagttacaattattattaatttctattgggtaacataccaagtttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783313 |
gctcttgcttcttgggagttacaattattattaatttctattgggtaacataccaagtttc |
30783253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 30783250 - 30783204
Alignment:
| Q |
164 |
taaacaagtacaaagtgccagttgaactagtactaggtagtataatc |
210 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
30783250 |
taaacaagtacaaagaggcagttgaaccagtactaggtagtataatc |
30783204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University